Population Genetics Glossary
Population Ecology, ZOO 4400/5400

Return to Main Index page

        Return to Lecture 35 (28-Apr) notes

Glossary and Bibliography of terms in population and molecular genetics, systematics etc.
+ computer software sources and a limited bibliography

Glossary of terms: (underlined terms in blue are hyperlinked cross-references)

Allele: a variant segment of the genetic material. Diploid organisms will have two potential alleles for any particular stretch (gene, sensu latu) of DNA (e.g., a 'normal' and a 'mutant' allele for Drosophila trait such as eye color). If the alleles are the same (or indistinguishable) on both chromosomes, the individual is a homozygote, if the alleles differ, a heterozygote. Bateson and Saunders (1902) originally coined the term for traits alternative to one another in Mendelian inheritance (Gk. Allelon, one another; morphe, form). Now used for alternative forms at a genetic locus. Codominant alleles are particularly useful as genetic markers.

Allopatric: having non-overlapping geographic ranges. Cf. sympatric,

Allozymes: Codominant protein variants (alleles) that can be visualized by appropriate staining and starch-gel electrophoresis. These were the first major molecular genetic markers, developed in the late 1960’s.

Assignment (test):  A method of assigning individuals to the populations from which they were most likely to have originated (regardless of where they dispersed to or were sampled).  A web-based assignment calculator is at: http://www.biology.ualberta.ca/jbrzusto/Doh.html.  [See also Davies, N., F.X. Villablanca, and G.K. Roderick. 1999. Determining the source of individuals: multilocus genotyping in nonequilibrium population genetics. Trends Ecol. Evol. 14: 17-21; Waser, P.M., and C. Strobeck. 1998. Genetic signatures of interpopulation dispersal. Trends Ecol. Evol. 13: 43-44].   J.M. Cornuet's GeneClass does Bayesian and other assignment tests: http://www.ensam.inra.fr/urlb/

Assortative mating: Nonrandom mating systems in which like pairs with like. Cf. Disassortative mating, Random mating.

Assumptions: A critical portion of any model of the genetic structure of populations or taxa. Most models make simplifying assumptions concerning drift, mutation or linearity that will be violated to some degree by almost every actual data set. The key point is whether the violations are sufficient to invalidate the conclusions of the model. A robust analysis is one whose conclusions are insensitive to violations of the assumptions.

Autosome: chromosome other than a sex chromosome.

‘Beanbag’ genetics: An initially derogatory term for the classical basis of population genetics founded by Sewall Wright, J.B.S. Haldane, and R.A. Fisher. Manipulation of counts of gene and genotype frequencies based on the forces of mutation, drift, migration, selection and non-random mating provide the basis for a theoretical understanding of evolution.

Bottleneck: Reduction in population size that can have major influence on genetic variation because of the relationship between genetic drift and population size.

bp: Abbreviation of 'base pairs' (nucleotides).

Clade: Monophyletic group of taxa.

Cladistics: School of phylogenetic analysis emphasizing the branching patterns of monophyletic taxa relying on synapomorphies (vs. symplesiomorphies) to unite sister taxa. [See Avise, pp. 34-39, 121-122].

Cladogram: A diagram, in the form of a stylized tree, showing inferred historical branching patterns among taxa.

Codominant: expression of heterozygote phenotypes that differ from either homozygote phenotype. Microsatellites are codominant genetic markers, because one can distinguish a heterozygote (two bands) from each of the homozygotes (single band).

Coefficient of relatedness (r): A measure of the degree of relatedness between individuals, ranging from —1.0 (no genes in common, at least over the genetic markers assayed) to +1.0 (identical twins or clones). In an outbred diploid population, siblings should have r = 0.5, individuals chosen at random should have r = 0.0. This measure is the foundation of Hamilton's (1964) theory of kin selection, which sparked a revolution in the study of animal behavior, behavioral ecology and the analysis of fitness. [See Avise p. 191; Queller and Goodnight, 1989].

Congruence: Agreement among or within phylogenetic data sets.

Diploid:  Having a double complement of chromosomes (generally a paternal and a maternal set).  Many genetic analyses are conducted on taxa whose cells are usually diploid.  Exceptions to diploidy include haploid gametes, haplo-diploid males in hymenoptera, polyploid species (particularly in plants, but a recent mammalian example exists!), and haploid stages in some complex life cycles.

Disassortative mating: Nonrandom mating system in which unlike individuals pair.  Cf. Assortative mating, Random mating.

Effective population size: see Ne.

Electrophoresis: polarized acetate, agarose or acrylamide gel through which one runs proteins or DNA. The material then separates by weight or polarity and allows one to distinguish variants (e.g., alleles, enzyme variants). [-phoresis; from the Greek for ‘to carry’]. [See Avise, Fig. 3.2, p. 48, and Fig. 3.3, p. 50].   Allozymes refer to enzyme variants used as genetic markers.

Endemism:  occurring in only one restricted locality.  Island species are often endemic (not found on adjacent mainland).  High levels of endemism (e.g., plants and invertebrates in Florida sand-pine scrub habitats) suggest a history of geographical isolation.  South American mountain ranges, for example, have very high rates of endemism for plants and animals.

Evolutionary forces:  Five major forces can cause evolutionary change:    MEMORIZE THESE!

Natural selection
Genetic drift (or population size)
Non-random mating
Migration (in the genetic sense of permanent movement of genes from one location to another)
Exon: Section of the DNA that codes for amino acids. See intron.

Fitness: Easiest to encapsulate in its population genetics sense as the relative rate of increase of a genotype under viability selection alone. Metz et al. (1992) discuss the concept in a TREE article, Grafen (1982) discusses inclusive fitness, Danchin et al. (1995) and McGraw and Caswell (1996) discuss measuring fitness from real-world data. For many cases, the matrix population parameter l can be taken as a measure of fitness (Caswell, 1989, p. pp. 163-171). [If l > 1 then the genotype increases, if l < 1 then it decreases].

Flanking region: for microsatellites, the flanking regions are the stretches of DNA outside the simple sequence tandem repeat. These sequences are used as primer pairs. The flanking regions are usually invariant across a population or species, but mutations in the flanking region can be a cause of null alleles as well as a potentially serious source of homoplasy (see Pemberton et al. 1995).

Forensic: Of or relating to courts or legal matters. Molecular markers are increasingly common in the context of forensics, both in wildlife and human cases involving identity or relatedness.

F-statistics: a measure of genetic structure developed by Sewall Wright (1969, 1978). Related to statistical analysis of variance  (ANOVA)
FST is the proportion of the total genetic variance contained in a subpopulation (the S subscript) relative to the total genetic variance (the T subscript). Values can range from 0 to 1. High FST implies a considerable degree of differentiation among populations.
FIS (inbreeding coefficient) is the proportion of the variance in the subpopulation contained in an individual. High FIS implies a considerable degree of inbreeding.
Related measures: q (theta) of Weir and Cockerham (1984) and GST of Nei (1973, 1978). [See Weir, 1996; Avise, Box 6.3, p. 206].

Gene diversity (expected heterozygosity): A measure of genetic variation in a population. It is calculated from the squared gene (= allele) frequencies. See Weir (1996) p. 124 for the formula.

Gene flow:  movement of genes from one population to another, causing them to become more similar.  Genetic migration is the primary agent of gene flow.

Gene frequencies: The term used in population genetics for allele frequencies.

Genetic distance: various statistics for measuring the 'genetic distance' between subgroups or populations. Major distance measures include Nei's distance (1972, 1978), Reynold's distance (Reynolds et al. 1983) and new distance measures that incorporate the stepwise mutation process in microsatellites (RST of Slatkin 1995a, b; D of Shriver et al., delta mu of Goldstein et al. 1995).

Genetic drift: a force that reduces heterozygosity by the random loss of alleles.  Drift is inversely related to population size.  Infinitely large populations (an assumption of the Hardy-Weinberg equilibirum) will not experience drift, whereas small populations will experience major effects of drift.  Drift is one of the major forces of evolutionary change (along with natural selection, mutation, genetic migration, and non-random mating).  The equilibrium/balance between drift and mutation is a major focus of much of population genetics.

Genetic markers: any trait used as a marker of genetic variation with in and among individuals and taxa. Traits used include phenotypic traits (eye color), protein products (allozymes, albumin), and segments of the DNA. One might use a particular genetic marker as a diagnostic trait (is this meat a legal elk or Rancher Smith's prize bull?; does this person have a heritable genetic disorder?), as a tool for management (how different are trout in Wyoming from trout in Colorado?), as an aid to systematic analyses, or in a huge variety of ways in basic evolutionary biology. Different genetic markers (e.g., microsatellites, mtDNA, allozymes, RAPD's) have different scopes (fine-grained vs. coarse-grained analyses), and different advantages and disadvantages (e.g., specificity, cost, ease of analytical interpretation of the resulting data).

Genome size: The genome is the collective term for all the complement of hereditary material found in an organism (e.g., all the DNA in the set of chromosomes in eukaryotes). Genome size ranges from approximately 104 base pairs (bp) in some viruses to approximately 1010 in many angiosperm plants, to > 1010 in some salamanders and fishes. Mammals have approximately 2-3 X 109 bp. Although polyploidy can increase genome size, most increase seems to be due to relatively small duplication events (because genome sizes within taxa tend to be approximately normally distributed around an intermediate modal size. [See Ayala, 1982, pp. 219-22].

Genotype: The set of DNA variants found at one or more loci in an individual. The information from which genotypes are developed could include allozyme alleles, microsatellite alleles, or sequence information (we then usually refer to haplotypes).  Cf. phenotype.

Haldane’s rule: "When in the F1 offspring of two different animal races one sex is absent, rare, or sterile, that sex is the heterozygous [heterogametic] sex." [See Avise, p. 289].

Haploid: having a single complement of chromosomes. See diploid.

Hardy-Weinberg principle: (Hardy-Weinberg Equilibrium is abbreviated HWE)   Given certain simplifying assumptions such as no genetic drift (= infinite population size), random mating, non-overlapping generations, no selection and no (genetic) migration, the genotype frequencies in an infinite population can be predicted from the gene frequencies, p and q by the formula:

p2 + 2pq + q2 A population will achieve Hardy-Weinberg equilibrium (HWE) in a single generation (unless one of the assumptions listed above is violated). We test for HWE by comparing observed and expected genotype frequencies.  An amazing proportion of the subject matter of population genetics is centered on how/why populations deviate from HWE.

Heritability: h2 = narrow-sense heritability in quantitative genetics = VA/VP, where VA is the additive genetic variance and VP is the phenotypic variance.  Heritability (in the narrow sense) enters into the response to selection R,
where R =h2S, and S is the intensity of selection.  See Gillespie (1998) p. 129, Hartl (2000) pp. 166-167.

Heterogametic sex: the sex whose sex chromosomes are different from each other. In mammals, most other vertebrates and most insects, males are the heterogametic sex (XY), whereas in birds, lepidopterans, and some fish it is females (WZ). Chromosomal sex determination is not universal (alternatives are phenotypic and allelic sex determination).

Heterozygosity (expected): An individaul or population-level parameter. The proportion of loci expected to be heterozygous in an individual (ranging from 0 to 1.0).
HO (observed heterozygosity) is the observed proportion of heterozygotes, averaged over loci.
HE (expected heterozygosity) is also known as gene diversity (= D; preferred, less ambiguous term) and is calculated as 1.0 minus the sum of the squared gene frequencies. [See Weir, 1996, p. 124 for the multi-locus, multi-allele formula].

Homology: having the same origin (used for genes or characters deriving from a common ancestor).

Homoplasy: similarity of traits or genes for reasons other than coancestry (e.g., convergent evolution, parallelism, evolutionary reversals, horizontal gene transfer, gene duplications). Homoplasy violates a basic assumption of the analysis of genetic markers -- variants of similar phenotype (e.g., base pair size) are assumed to derive from a common ancestor. [See Sanderson, M., and Hufford. 1996. Homoplasy: The Recurrence of Similarity in Evolution. Academic Press, NY ISBN 618030-X].

HWE: see Hardy-Weinberg.

Hypervariability: High degree of variation among individuals within local populations at a given genetic marker. Examples of hypervariable markers include minisatellites and microsatellites.

Independent assortment: During gamete formation segregating pairs of unit factors (e.g., genes controlling color or shape traits) assort independently of each other.  As a result, one can use multiplicative probabilities to compute multi-trait or multigene phenotypes or genotypes. Linkage disequilibrium can prevent the expected probabilities from being realized.

Individualization: buzzword (largely restricted to forensics applications) to embrace the idea that molecular markers can facilitate distinguishing individuals.

Intron: DNA sequences within the protein-coding sequences of a gene; introns are transcribed into mRNA but are cut out of the message before it is translated into protein. Introns may contain sequences involved in regulating expression of a gene. See exon.

Isolate breaking: Excess heterozygosity (over Hardy-Weinberg expectation) observed when divergent populations or subpopulations establish secondary contact.  The opposite of the Wahlund effect.

Isozymes: Enzyme variants with the same functional role, but differing in 1°, 2°, 3° or 4° structure. In some cases, isozymes may be multimers produced by multiple genes. They may, therefore, not qualify as codominant allozymes for use as genetic markers.

Karyotype:  the complement of chromosomes (e.g., 2n = 46 in humans) that constitute the genetic material of a eukaryote.

Ladder: A series of known-size fragments run in a gel to allow sizing of fragments of target DNA run in other lanes. One commonly used ladder is phage lambda cut with a restriction enzyme [yields fragments of 216, 211, 200, 164 and 150 bp].

Lambda: Lambda (l) phage DNA is a useful tool in molecular biology. Because its entire sequence is known (= 50Kb double-stranded), it is often used to create a ladder of known-size fragments for sizing bands on gels. It is also a useful cloning vector.

Locus: from the Latin for 'place'. A stretch of DNA at a particular place on a particular chromosome — often used for a 'gene' in the broad sense, meaning a stretch of DNA being analyzed for variability (e.g., a microsatellite locus).

Marker: see Genetic marker.

Microsatellites: Short tandem repeats (e.g., ACn, where n > 8) of nucleotide sequences -- the tandem units can be dinucleotides, trinucleotides or tetranucleotides. The apparent mutation process is by slippage replication errors, where the repeats allow matching via excision or addition of repeats. Because this sort of slippage replication is more likely than point mutations, microsatellite loci tend to be hypervariable. The usual procedure is to use an oligo (e.g., AC10) as a probe, screen a genomic library and then sequence positive clones to develop primer pairs that can be used to amplify the target DNA with the PCR.  Alternative name is SSTR (simple sequence tandem repeat). [See also McDonald and Potts (1997), or 1-page intro. at http://www.uwyo.edu/zoology/McDONALD.HTM].

Migration: In population genetics, migration means the (permanent) movement of genes into or out of a population. Thus, a 'migrating' warbler does not cause any migration (in the genetic sense) by moving from breeding grounds in Wyoming to wintering grounds in Mexico and then returning to breed in the same Wyoming locale.  We refer to the process of genes moving among populations as gene flow.

Minimum viable population size:  See Nunney, L., and K.A. Campbell. 1993. Assessing minimum viable population size: demography meets population genetics. Trends Ecol. Evol. 8: 234-239.

Minisatellites: [see VNTR]. Segments of repeated DNA often used as genetic markers for individual identification (forensic DNA 'fingerprinting') or analyses of relatedness. Can be either single- or multi-locus. Minisatellite technology relies on probe-based hybridization. Advantages include lack of need for specific primers and hypervariability. Disadvantages include inability to use PCR amplification, the need for Southern blotting, and, for multi-locus minisatellites, the lack of locus-specificity (making population genetic analyses difficult). [See Avise, Fig. 3.16, p. 80].

Molecular clock hypothesis: Hypothesis that molecular change is linear with time, and constant over different taxa and in different places. If that is so, then the sequence difference between homologs in different taxa can be used to estimate time since divergence. [See Avise text, pp. 100-109].

Monophyletic group (clade): Evolutionary assemblage of taxa that includes a common ancestor and all of its descendants. [See Avise, p. 36].

MtDNA: mitochondrial DNA. Sequencing of mtDNA is a widely used technique in systematics. The mostly maternal, clonal transmission of mt-DNA provides both opportunities and problems for phylogenetic analysis. [See Avise, p. 63].

Ne: Effective population size. Many factors include fluctuating population size, sex ratio (Ne = (4Nm*Nf)/(Nm+Nf), age of reproduction (overlapping generations), the spatial dispersion of the population (Ne = 4ps2d) and family size can affect Ne. Usually, Ne will be less than N (the census population size) in natural populations. If, however, the distribution of family sizes is more uniform than Poisson, then Ne can be > N. Ne is a fundamental component of many population genetics formulations.   Often, however, it is found in the term 4Nm or 4Nm (mutation or migration respectively) and hence cannot be estimated by itself.  See Crow and Kimura (1970) for an overview; Ewens (1982), Harris and Allendorf (1989), Caballero and Hill (1992), and Nunney and Elam (1994) also discuss the concept.  Hartl's (2000) primer of population genetics has a useful summary on pp. 96-98.

Non-synonymous substitution: A nucleotide substitution (mutation) that results in a different amino acid. More likely for first and second position codons.

Nucleotides: the building blocks of DNA (and RNA).  DNA nucleotides consist of a nitrogenous base, a deoxyribose sugar and a phosphate group.

OTU: Operational taxonomic unit. Examples include populations, species, genera, and families. For phylogenetic analyses, the OTUs will be terminal taxa (i.e., occur at the branch tips of the tree).

Outgroup: Taxon phylogenetically outside the clade of interest (the ingroup). When one uses an outgroup in phylogenetic inference, the ingroup is implicitly assumed to be monophyletic.  Best reference point for determining polarity (direction of character change/whether a character is or isn't ancestral). [See Avise, p. 36; p. 416 of Molecular Systematics, 2nd edn.].

Panmixia: Absence of any differentiation among subpopulations (because of high levels of gene flow, creating effectively one single large population with no internal structure).  The adjective is panmictic.

PCR: polymerase chain reaction. Technique for amplifying nucleic acids in a thermal cycler. Involves use of forward and reverse primer pairs that start off the reaction. End yield is many orders of magnitude more DNA of the target sequence than one started with. The resulting amplified DNA can then be visualized with stains or radioactive labeling, or sized with fluorescent markers in a sequencer. [See Avise, p. 84, Fig. 3.18, p. 85].

Phenotype: the outward expression of a genotype.  This "visible" variation might be expressed as coat color in a mouse, as the odor of a secondary compound (mint or sagebrush), or as the length of a DNA fragment on an electrphoretic gel.  Cf. genotype.

Phylogeography: Study of the patterns of genetic differentiation across landscapes, often involving intraspecific variation and the comparison of patterns across a range of different taxa in the same region (phylogenetic biogeography). Pioneered by John Avise.

Polymerase chain reaction: See PCR.

Polyploid: having more than two sets of homologous chromosomes.  A common route to speciation in plants.  Recently, researchers discovered a polyploid South American rodent.

Primer: Short, preexisting single-stranded polynucleotide chain to which new deoxyribonucleotides can be added by DNA polymerase (to 'prime' PCR amplification). The primer anneals to a nucleic acid template (DNA of the organism of interest) and promotes copying of the template, starting from the primer site. To amplify microsatellites one uses a forward and reverse primer pair:

[agctcagtccctagtcagtact]acacacacacacacacacacac[ggtacttcggagctatccgaattccct] In this example the italicized bp are the forward and reverse primers (should not differ among individuals), whereas the unitalicized 'ac' repeat is the microsatellite. By running back and forth across the repeat one can amplify a few copies of the microsatellite region by orders of magnitude, yielding sufficient DNA to allow visualization of the amplified product on an acrylamide gel by staining with ethidium bromide.
Some primer sequences may be conserved across wide taxonomic gaps (e.g., across families), while others may differ even among congeners.

Probe : Single-stranded DNA or RNA molecules of specific base sequence, labeled either radioactively, immunologically, or by other means, that are used to detect the complementary base sequence by hybridization. Some genetic markers (e.g., minisatellites) depend on probe-based techniques.

r: See Coefficient of relatedness .

Random mating: A fundamental simplifying assumption for many population genetics models. Non-random mating may be assortative (birds of a feather), disassortative (opposites attract) or skewed (hotshots). For example, for Hardy-Weinberg equilibrium, random mating is required.

Recombination: Exchange of gene segments by crossing over at chiasmata (exchange of material between non-sister chromatids). The exchanged sections are usually homologous. The likelihood of recombination increases with increasing physical distance.

Relatedness:  See coefficient of relatedness.

Sequencing: Molecular techniques for deducing the nucleotide composition of the DNA. The two major alternatives are Maxam-Gilbert sequencing, and Sanger/dideoxy sequencing. [See Avise, 1996, Fig. 3.17, p. 83; Russell, 1992, pp. 458-462; Miyamoto and Cracraft, 1991].

Silent substitution: mutation in a coding/expressed region of the DNA that produces no change in the amino acid coded for (because of the redundancy of the genetic code).  Also known as synonymous substitution.

Simple sequence tandem repeat: See microsatellite.

Slippage replication:  A mutation process whereby a simple sequence tandem (microsatellite) repeat grows by addition or subtraction of the "beads" of simple units that make up the "necklace".  A dinucleotide AC repeat would grow by addition or subtraction of AC units.

Stepwise mutation: Microsatellite variation appears to result from slippage in replication, which is most likely to add or delete a single repeat unit (steps of one). As a result, alleles more similar in size will presumably be more closely related. This additional 'phylogenetic' information can be used in assessing genetic differentiation or genetic distance.

Sympatric: occurring in the same geographic area. Cf. allopatric.

Synonymous substitution: A nucleotide substitution that does not result in a different amino acid (e.g., any codon beginning CC will code for proline, regardless of the codon in the third position). Also known as a "silent" substitution.  Synonymous substitutions result from the degeneracy (redundancy) of the genetic code at the third codon position. A non-synonymous substitution changes the amino acid coding. [See Avise, Fig. 4.2, p. 102].

Taxon (plural taxa): Group of organisms linked by common ancenstry.  Taxa can range in scale from populations to kingdoms.

Thermal cycler: the 'engine' or PCR machine, in which the PCR is performed.

Transition: a point mutation in the DNA in which replacement is by a similar nucleotide. I.e., a purine (A and G) by a purine or a pyrimidine (C or T) by a pyrimidine. Transitions happen more often than transversions.  The dissimilar rates of mutation can be incorporated in phylogenetic inference by various weighting schemes.  [See pp. 432-438 of Mol. Syst., 2nd edn.].

Transversion: a point mutation in the DNA in which replacement is by a dissimilar nucleotide. I.e., a purine (A or G) is replaced by a pyrimidine (C or T) or vice versa. Cf. transition.

Visualization: technique for assessing variation among DNA segments (genetic markers). Methods include radiolabeling (exposure of gels to x-ray film) and various stains (ethidium bromide, silver stains etc.).

Wahlund effect: Reduction in homozygosity (increase in heterozygosity) when distinct taxa are analyzed jointly, or when they hybridize.  Whenever subpopulations vary in gene frequency, the population as a whole will show a Wahlund effect.  The opposite effect, known as isolate breaking, occurs when divergent populations intermix.  In that case, the interbreeds will show an increase in heterozygosity over the Hardy-Weinberg expectation.

Useful reference texts: (* means copy in McDonald library) *Avise, J.C. 1994. Molecular Markers, Natural History and Evolution. Chapman and Hall, New York.

*Brooks, D.R., and D.A. McLennan. 1991. Phylogeny, Ecology, and Behavior. Chicago Univ. Press, Chicago.

*Ferraris, J.D., and S.R. Palumbi (eds.). 1996. Molecular Zoology: Advances, Strategies, and Protocols. Wiley-Liss, NY. 580 pp.

*Gillespie, J. H. 1998. Population Genetics: A Concise Guide. The Johns Hopkins University Press, Baltimore, Md. On Reserve       ISBN  0-8018-5755-4 $19.95

*Hartl, D.L. 2000. A Primer of Population Genetics (3rd ed.). Sinauer Associates, Sunderland, MA.

*Hartl, D.L., and A.G. Clark. 1989. Principles of Population Genetics. Sinauer Associates, Sunderland, MA. [3rd edition is now available]

*Hillis, D.M., C. Moritz, and B.K. Mable (eds.). 1996. Molecular Systematics (2nd ed.). Sinauer Associates, Sunderland, MA.
[Has useful Glossary]

Hoelzel, A.R., and G.A. Dover. 1991. Molecular Genetic Ecology. IRL Press, Oxford U. Press, Oxford
SCI QH 455.H64 1991.

Kendrew, J.C. 1994. The Encyclopedia of Molecular Biology . Blackwell Science, Oxford
SCI REF CALL #: QH506 .E53 1994

*Li, W. 1997. Molecular Evolution. Sinauer Associates, Sunderland, MA.

*Maddison, W.P., and D.R. Maddison. 1992. MacClade: Analysis of Phylogeny and Character Evolution. Sinauer Associates, Sunderland, MA. V. 3.

Martins, E.P., and T.F. Hansen. 1997. Phylogenies and the comparative method: a general approach to incorporating phylogenetic information into the analysis of interspecific data. Am. Nat. 149: 646-667.

Rieger, R, A. Michaelis, and M.M. Green. 1991. Glossary of Genetics : Classical and Molecular, 5th edn. Springer-Verlag, Berlin
SCI REF CALL #: QH427.R54 1991

Russell, P.J. Genetics, 3rd Edition. Harper, Collins, New York.
UW Science library call # QH 430.R87 1992.

*Weir, B.S. 1996. Genetic Data Analysis II: Methods for discrete population genetic data (2nd ed.). Sinauer Assoc., Sunderland, MA.

Literature cited: Ayala, F.J. 1982. Population and Evolutionary Genetics: A Primer. Benjamin/Cummings, Menlo Park, CA.
QH 455.A94 1982

Caballero, A., and W.G. Hill. 1992. A note on the inbreeding effective population size. Evol. 46: 1969-1972.

*Caswell, H. 1989. Matrix Population Models. Sinauer Associates, Sunderland, Mass.

Danchin, E., G. Gonzalez Davila, and J.D. Lebreton. 1995. Estimating bird fitness correctly by using demographic-models. J Avian Biol. 26: 67-75.

Ewens, W.J. 1982. On the concept of effective population size. Theor. Pop. Biol. 21: 373-378.

Freifelder, D.M. 1987. Molecular Biology, 2nd edn. Boston: Jones and Bartlett
CALL #: QH 506 .F73 1987

Goldstein, D.B., A.R. Linares, L.L. CavalliSforza, and M.W. Feldman. 1995. An evaluation of genetic distances for use with microsatellite loci. Genetics 139: 463-471.

Grafen, A. 1982. How not to measure inclusive fitness. Nature 298: 425-426

Harris, R.B., and F.W. Allendorf. 1989. Genetically effective population size of large mammals: an assessment of estimators. Conserv. Biol. 3: 181-191.

Hartl, D.L. 2000. A Primer of Population Genetics (3rd ed.). Sinauer Associates, Sunderland, MA.

McDonald, D.B., and W.K. Potts. 1997. Microsatellite DNA as a genetic marker at several scales. pp. 29-49 In Avian Molecular Evolution and Systematics (D. Mindell, ed.). Academic Press, New York.

McGraw, J.B., and H. Caswell. 1996. Estimation of individual fitness from life-history data. Am. Nat. 147: 47-64.

Metz, J.A.J., R.M. Nisbet, and S.A.H. Geritz. 1992. How should we define 'fitness' for general ecological scenarios? TREE 7: 198-202

Miyamoto, M.M., and J. Cracraft. 1991. Phylogenetic Analysis of DNA Sequences. Oxford University Press, Oxford.

Nei, M. 1972. Genetic distance between populations. Am. Nat. 106: 283-292.

Nei, M. 1973. Analysis of gene diversity in subdivided populations. P.N.A.S., USA 70: 3321-3323.

Nei, M. 1977. F-statistics and the analysis of gene diversity in subdivided populations. Ann. Hum. Genet. 41: 225-233.

Nei, M. 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 76: 379-390.

Nunney, L., and D.R. Elam. 1994. Estimating the effective population size of conserved populations. Conserv. Biol. 8: 175-184.

Pemberton, J.M., Slate, J., Bancroft, D.R., and Barrett, J.A. (1995). Nonamplifying alleles at microsatellite loci: a caution for parentage and population studies. Mol. Ecol. 4, 49-52.

Queller, D.C., and K.F. Goodnight. 1989. Estimating relatedness using genetic markers. Evol. 43: 258-275.

Reynolds, J., B.S. Weir, and C.C. Cockerham. 1983. Estimation of the coancestry coefficient: Basis for a short-term genetic distance. Genetics 105: 767-779.

Shriver, M.D., L. Jin, E. Boerwinkle, R. Deka, R.E. Ferrell, and R. Chakraborty. 1995. A novel measure of genetic distance for highly polymorphic tandem repeat loci. Mol. Biol. Evol. 12: 914-920.

Slatkin, M. 1995a. A measure of population subdivision based on microsatellite allele frequencies. Genetics 139: 457-462
Genetic structure; stepwise mutation model. CORRECTION NEXT

Slatkin, M. 1995b. A measure of population subdivision based on microsatellite allele frequencies (vol. 139, pg. 457, 1995). Genetics 139: 1463

Swofford, D.L. 1996. PAUP: Phylogenetic Analysis Using Parsimony (and Other Methods), version 4.0. Sinauer Associates, Sunderland MA.

Swofford, D.L., G.J. Olsen, P.J. Waddell, and D.M. Hillis. 1996. Phylogenetic inference. Chapter 11, pp. 407-514 In: Molecular Systematics, 2nd ed. (D.M.. Hillis, C. Moritz, and B.K. Mable, eds.). Sinauer Associates, Sunderland, MA.

*Weir, B.S. 1996. Genetic Data Analysis II: Methods for discrete population genetic data (2nd ed.). Sinauer Assoc., Sunderland, MA.

Weir, B.S., and C.C. Cockerham. 1984. Estimating F-statistics for the analysis of population structure. Evol. 38(6): 1358-1370.

Wright, S. 1969. Evolution and the Genetics of Populations, Vol. 2. University of Chicago Press, Chicago.

Wright, S. 1978. Evolution and the Genetics of Populations, Vol. 4. University of Chicago Press, Chicago.

Genetic analysis programs--Web sites (these may change!): The Appendix to Chapter 11 of Hillis et al. (1996) has a list of computer software packages useful for phylogenetic analyses.
Assignment calculator:    Online or download.  Assigns individuals to populations by log-likelihood values. http://www.biology.ualberta.ca/jbrzusto/Doh.html BOTTLENECK  1.2.02   Windows            25-Nov-99   * Uses GENEPOP input format
Detecting recent effective population size reductions from allele data frequencies
Cervus: "a Windows-based package for parentage analysis using a likelihood approach. Taking co-dominant marker data in text format, CERVUS calculates allele frequencies, runs simulations and carries out parentage analysis within a single, easy-to-use framework."
Marshall, TC, Slate, J, Kruuk, L and Pemberton, JM (1998)  Statistical confidence for likelihood-based paternity inference in natural populations.  Mol. Ecol. 7: 639-655.
FSTAT Version 2.8      Windows        25-Nov-99   * A program by Goudet that calculates F-statistics for (mostly) microsatellite data
GDA. Windows/PC    Performs various population genetics analyses. Based partly on Weir (1996)
GENECLASS Windows            25-Nov-99   * GeneClass is a program for assignment and exclusion using molecular markers
(similar to, but more diverse than Paetkau assignment testing).  By J. Cornuet.
GENEPOP. Performs various population genetics analyses. Based on Raymond and Rousset (1995).
Via anonymous ftp from:
ftp.cefe.cnrs-mop.fr/pub/msdos/genepop [DOS]
Kinship: "Kinship 1.1 tests hypotheses of pedigree relationships between pairs of individuals using data from codominant, single-locus genetic markers (such as DNA microsatellites)."
Migrate:  Macintosh   "Migrate estimates population parameters (effective population size and migration rates) using genetic data (allozymes, microsatellites, sequence data). It is a maximum likelihood estimator and uses a coalescent theory approach taking into account history of mutations and uncertainty of the genealogy."  by Peter Beerli
Beerli, P. and J. Felsenstein. 1999. Maximum likelihood estimation of migration rates and effective population umbers in two populations using a coalescent approach. Genetics 152:763-773.
MISAT. Microsatellite analysis by maximum likelihood http://ib.berkeley.edu/labs/slatkin/rasmus/MISAT.1.0.hqx
misat  1.0 for PowerMac    Summer-99   *
    Calculates 4Nµ (R. Nielsen)
PHYLIP: Phylogenetic Inference Package (Version 3.5c, as of October 1996). Suite of phylogenetic analysis software programs for various platforms (PC, UNIX, and Mac/PowerMac). Neighbor-joining, UPGMA, Fitch-Margoliash and other tree-building methods. Developed by Joe Felsenstein, Univ. of Wash.
Relatedness  5.05. Macintosh.  Calculates r (coefficient of relatedness). Based on Queller and Goodnight (1989)
RSTCalc 2.2:  Windows/PC  Calculates an unbiased version of Slatkin’s (1995) RST. Goodman, SJ 1997. Rst Calc: a collection of computer programs for calculating estimates of genetic differentition from microsatellite data and a determining their significance.Molecular Ecology 6: 881-885.
TFPGA (Tools for Population Genetic Analyses): http://herb.bio.nau.edu/~miller/index.html
Glossaries and other resources on the web:
    Kimball's Biology Pages (http://www.ultranet.com/~jkimball/BiologyPages)
General bio. glossary and mini-essays, with an emphasis on molecular and cell biology.
Return to top of page